28gIII GTATGGGATTTTGCTAAACAAC
3AOX GCAAATGGCATTCTGACATCC
3CMVFW GGTCTATATAAGCAGAGC
3end GGATCGCGAAAACTGTGG
3END2 TTGCCGTAATGAGTGACC
3pLG112 CCATATAAATCAGCATCC
5AOX GACTGGTTCCAATTGACAA
5pLG112 TTTGAAGCATAAGAATAG
5ProLar GTGAGCGCTCACAATTATG
96gIII CCCTCATAGTTAGCGTAACG
Ac5Forward GACACAAAGCCGCTCCATCAG
AD3-5 GCGTTTGGAATCACTACAGG
AP4 CCCCTGTGAGGAACT
attL1 TCGCGTTAACGCTAGCATGGATCTC
attL1.AP CCTTTTTGCGTTTCTACA
attL2 GTAACATCAGAGATTTTGAGACAC
attP1 GTAAAACGACGGCCAG
attP2 CAGGAAACAGCTATGAC
Bac1Primer AACCATCTCGCAAATAAATA
Bac2Primer ACGCACAGAATCTAGCGCTT
BacRev2 GCTTCATCGTGTCGGGTTTA
BACreverse CTGTAAATCAACAACGCACAG
BaculoFor. TTTACTGTTTTCGTAACAGTTTTG
BaculoRev. CAACAACGCACAGAATCTAGC
BFPFor CATGGCATGGATGAACTGTA
BRDGMCSII3 GCAATTCCTTACCTTCCA
BRDGMCSII5 TGACGTGCCTGACTATGC
C-CMV-24 TATTAGGACAAGGCTGGTGGGCAC
CON2 CAGTGTGCCGGTCTCCGT
DuetDOWN1 GATTATGCGGCCGTGTACAA
DuetUP2 Primer TTGTACACGGCCGCATAATC
EBVRev GTGGTTTGTCCAAACTCATC
EF-1aforward TCAAGCCTCAGACAGTGGTTC
EGFP-380 AGGGCGAGGGCGATGCCACCTA
EGFP-Cnew CATGGTCCTGCTGGAGTTCGTG
FastBacFwd GTTTTCGTAACAGTTTTG
FastBacFwdB TTCCTTCCGGTATTGTCTCC
FastBacRev AGGGGGAGGTGTGGGAGG
FastBacRevB TTTAATTCAACCCAACACAA
f-xa.11 GGTCCTGCAACTTTATCC
f-xa.13 GCTCATCATTGGAAAACG
f-xa.15 TCTTCCCTTCCTTTCTCG
f-xa.3 CGCACCAAATGACTTAGC
f-xa.5 TCTCCAACTCCTAATCTC
f-xa.7 GGCGAAACCCGACAGGAC
f-xa.9 TGATCCGGCAAACAAACC
f-xa.A GAGCCCCCGATTTAGAGC
f-xa.C GAACGTTTTCCAATGATG
f-xa.E GGAGGCGGATAAAGTTGC
f-xa.G AAAAACCACCGCTACCAG
f-xa.J TAGTCCTGTCGGGTTTCG
f-xa.L GATTAGGAGTTGGAGACC
f-xa.N TCAAGCTTGTCGTCATCG
f-xa.P CCAAGTGGGCAGTTTACC
GADREV GTTGAAGTGAACTTGCGGGG
GAL4A3 ACTTGCGGGGTTTTTCAG
GAL4Act TACCACTACAATGGATG
GAL4B3 CTGACCTACAGGAAAGAGTTAC
GAL4BD TCATCGGAAGAGAGTAG
GAL4Bnd TCATCGCAAGAGAGTAG
GFP.1 TTGTGTCCAAGAATGTTT
GFP.A GGCAACATTCTGGGACAC
GFPForward CGACACAATCTGCCCTTTC
GFPreverse CGTCGCCGTCCAGCTCGACCAG
GFPRevUS GGCCATGGAACAGGTAGT
GLprimer1 TGTATCTTATGGTACTGTAACTG
GLprimer2 CTTTATGTTTTTGGCGTCTTCCA
HaloTag.R ACGCTCGCCCAGGACTTC
INSECT-DEST39FWD GCCGCGTTGGTAGTAGAC
INSECT-DEST39REV ATGTGGTTTCGTGGATTC
IRES.REV TATAGACAAACGCACACC
LacZRev AGGCACCCCAGGCTTTAC
Lseqds CTCATTAGGCGGGCTCAG
LseqPrimer ATCACGAGGCCCTTTCG
LucB1 GCTCTCCAGCGGTTCCATC
M13-65 AGGCGATTAAGTTGGGTA
M13For GTTGTAAAACGACGGCCAGT
M13Rev TCACACAGGAAACAGCTATGA
Mal-E GGTCGTCAGACTGTCGATGAAGCC
MATCHMAKERBD3 CGTTTTAAAACCTAAGAGTCAC
MATCHMAKERBD5 TCATCGGAAGAGAGTAG
MDXF3 TTCAGGTTCAGGGGGAGG
MDXF5 TGCTGTTAACGGTGGAGG
Mono.F TCTTAGCGGTTCAAAGGT
Mono.R CCCACGGCCGTCATGCTC
MT-Upstream CAGCAGCAAAATCAAGTG
N-CMV-30 AATGTCGTAATAACCCCGCCCCGTTGACGC
Neo.11 TGTTGTGCCCAGTCATAG
Neo.13 GCTGACCGCTTCCTCGTG
Neo.15 GGCGATAGAAGGCGATGC
Neo.17 GCACGAGGAAGCGGTCAG
Neo.19 AAGCGGCCGGAGAACCTG
Neo.21 CGAAAGGGGGATGTGCTG
Neo.23 TGAAGCGTGCGAGAATGC
Neo.25 CGTCCTGCAGTTCATTCA
Neo.5 GATCTATAGATCTCTCGTGG
Neo.A ATGAGTGGGAGGAATGAG
Neo.C TTAACAAAGTATGACAGG
Neo-F TGGGCACAACAGACAATC
Neo-R TGGATACTTTCTCGGCAG
NEW1.3a ACCCATACGATGTTCCAGA
NEW1.3b CTTGCGGGGTTTTTCAGTA
NFP-650 CTGACAGAACATGCTATTGC
oQE30-Rev GTTCTGAGGTCATTACTGG
oQE31-III CGGATAACAATTTCACACAG
P119H3 CTTCCGGCTCGTATGTTG
p221F GACGGCCAGTCTTAAGCTCGGG
p221R CACTATAGGGGATATCAGCTGGATGGC
P63 CGCTTCTTCGCTATTACG
P65 CTCGTATGTTGTGTGGAA
pACT5 CACTTAGACGGCGAGGAC
pASKF GAGTTATTTTACCACTCCCT
pASKR CGCAGTAGCGGTAAACG
pBADForward ATGCCATAGCATTTTTATCC
pBADReverse GATTTAATCTGTATCAGG
pBR3223 GCTCATGAGCCCGAAGTG
pCAT3proFor CAAAACAAAACGAAACAA
pCAT3proRev GAGTTAGGGGCGGGATGG
pcDNA3.1BGHRev TAGAAGGCACAGTCGAGG
pCEP4Fwd CAGAGCTCGTTTAGTGAACCG
pCEPF GCATTCTAGTTGTGGTTTG
pCEPR GTGTACGGTGGGAGGTCTA
pCIN43 GAGTACTCACCCCAACAG
pCLXSN3 GGGGCGGGACTATGGTTG
pCLXSN5 CCCCTACATCGTGACCTG
PCMV5F ATGGGCGGTAGGCGTGTA
PCMV5R GCACTGGGGAGGGGTCAC
pCMVFOR GATCCGGTACTAGAGGAACTGAAAAAC
pCpG5 ACCTTCTTCTCTTTCCTC
pCRII F2 GCTTCCCAACCTTACCAGAG
pcWIN2 ATCGATGCTTAGGAGGTC
pcWIN2ds TGACTCTCTTCCGGGCGC
PDEST10 GTTCTAGTGGTTGGCTACGTATA
pDEST1520 GTGATCATGTAACCCATCCTGAC
pDsRed3 AGCGCATGAACTCCTTGA
pEE3 CGCCACCAGACATAATAG
pEE5 GGATCTTCCATACCTACC
pET-15b5 ATGCGTCCGGCGTAGAGG
PFLU-DW AGGGTCAAGGAAGGCACGGGGGAG
PFLU-UP CCCCTGCTATTCTGCTCAACCTTC
pFUSE.F TGTCCGGCGCTCCCTTGG
pFUSE.R CCACGCATGTGACCTCAG
PGEX2T.START TGCGCCGACATCATAACG
pGEX3 CCGGGAGCTGCATGTGTCAGAGG
pGEX5 GGGCTGGCAAGCCACGTTTGGTG
pGL33 CCAGCGGTTCCATCTTCC
pGL35 ATCAAAACAAAACGAAAC
pIEX4F TGTTGGATATTGTTTCAG
pIEX4R CCCTCGATAATAAAAGAC
pINDFor CTCTGAATACTTTCAACAAGTTAC
pIRES23 ACACCGGCCTTATTCCAA
PIRES-A3 CGCCCTAGATGCATGCTC
pIRES-B5 AAAAACACGATGATAAGC
PJF GCGAGAGTAGGGAACTGCCAGGCATC
PJR TTGAATATGGCTCATAACACCCCTTG
pJT4-5.5 GTTAACGATACCAGCCTC
pLexASeq CGTCAGCAGAGCTTCACCATTG
pLIB3 AGCCCTCACTCCTTCTCTA
pLIB5 ATGGCGTTACTTAAGCTAG
pLNCX23 ACCTACAGGTGGGGTCTTTCATTCCC
pLNCX23-200 GGCACAGGGTCATTTCAG
PM3 ATGTGGTATGGCTGATTATG
PMYR3 CTTCCTTTTCGGTTAGAG
PN3 CGCGTCAGCGGGTGTTGG
pNTZ-3SEQ CAGCAGCGCCAGGTCAGC
PolyhedronFor AAATGATAACCATCTCGC
PolyhedronRev GTCCAAGTTTCCCTG
pPGK GGGAGGAGTAGAAGGTGG
pQCXIP3 GAATTCCGCCCCTC
pQEVecPromRegion CCCGAAAAGTGCCACCTG
Primer1 CATAGCTGTTTCCTGTGTGA
pRLTK.F TGAAGGTGCCAAGAAGTT
pRLTK.R CGACACGGAAATGTTGAA
pSE3803 GGCATGGGGTCAGGTGGG
pSE3805 GGCTCGTATAATGTGTGG
pShuttle3 CAGGTTCAGGGGGAGGTG
pShuttle5 CAGAGCTGGTTTAGTGAA
Psi.F GGTGAAGGGCCTCCACTT
Psi.R TTCGTTCCTTCCCCCTCC
pShuttleIRESgfpF CTCACGGGGATTTCCAAGTC
pShuttleIRESgfpR ATGCAGTCGTCGAGGAATTG
pSuperF GGAAGCCTTGGCTTTTG
pSuperR CGAACGCTGACGTCATC
PT3 GAGCGCAGCGAGTCAGTG
pTRE2hyg.3 GTCCATGGTGATACAAGG
pTRE3 CCACACCTCCCCCTGAAC
pTRE5 CGCCTGGAGACGCCATCC
pTRIEX-3Neo3 ACACCAGCCACCACCTTC
pU6 TGTGGAAAGGACGAGGAT
pUAST3 CATCAGTTCCATAGGTTG
pUAST5 GCATGTCCGTGGGGTTTG
pVR10123 AAGGACAGTGGGAGTGGC
pVR10125 CGCCACCAGACATAATAG
pWPTFor CCGAGGGTGGGGGAGAAC
pWPTRev CATTAAAGCAGCGTATCC
QBGFPFOR TTGTTGAATTAGATGGTG
QBGFPREV GGGTAAGTTTTCCGTATG
RseqPrimer GATACTGGACGCGAGC
RVprimer3 CTAGCAAAATAGGCTGTCCC
RVprimer4 GACGATAGTCATGCCCCGCG
SG53 TAAGCTGCAATAAACAAG
SP6 ATTTAGGTGACACTATAG
S-Tagprimer GAACGCCAGCACATGGAC
SV40polyA-2 TGATTACGCCAAGCTCTAGC
SV40pro CTGAGCTATTCCAGAAGTAG
T3 ATTAACCCTCACTAAAGGG
T7 TAATACGACTCACTATAGG
T7gilmore ATAGTTCCTCCTTTCAGC
T7SELECTDOWN AACCCCTCAAGACCCGTTTA
T7SELECTUP GGAGCTGTCGTATTCCAGTC
T7term GCTAGTTATTGCTCAGCG
TempTest1 CGGCCTTTTTACGGTTCCTG
TempTest2 TGTAGGTCGTTCGCTCCAAG
TriEX2197.5 GCCTTCTGGTCTGGTCCC
TriEXDOWN.3 TCGATCTCAGTGGTATTTG
TriEXUP.5 GTTATTGTGCTGTCTCATC
Trplx3 CTCACTATAGGGCGAATTG
Trplx5 AAGCGCGCCATTGTGTTG
TSARD ACCCTCATAGTTAGCGTAACG
U19 GTTTTCCCAGTCACGACGT
U6+275 TGGAAAGGACGAAACACC
UBI AGTCCACCCTGCACCTG
VCPSnbF CGGTAAACTGCCCACTTG
VCPSnbR GTCCCGTTGATTTTGGTG
Vec2F GTCCCATTCGCCATTCAG
Vec2R GCAGCACATCCCCCTTTC
VecF CTTTGCCTTTCTCTCCACAG
VectorPrimer3 GCAGAGCTCGTTTAGTGAA
VP165 GACTTCGAGTTTGAGCAG
VP22rev CCGCGGACCCGACTTC
XpressFwd TATGGCTAGCATGACTGGT
YEp243 CTCATGAGCCCGAAGTGG
YEp245 CCAGTCCTGCTCGCTTCG